gfp lc3 plasmid (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
gfp lc3 plasmid
Gfp Lc3 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+lc3+plasmid/pEGFP-LC3+(human)+(Plasmid+%2324920)/pm41840861-154-11-14
Average 94 stars, based on 124 article reviews
Gfp Lc3 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+lc3+plasmid/pEGFP-LC3+(human)+(Plasmid+%2324920)/pm41840861-154-11-14
Average 94 stars, based on 124 article reviews
gfp lc3 plasmid - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Autophagy-driven MHC-I downregulation enables NK cell-mediated clearance of intracellular uropathogenic E. coli in urinary tract infection Article Snippet: .. The Article Title: Non-thermal atmospheric pressure plasma induces selective cancer cell apoptosis by modulating redox homeostasis. Article Snippet: .. An assay using the Article Title: Non-thermal atmospheric pressure plasma induces selective cancer cell apoptosis by modulating redox homeostasis Article Snippet: .. An assay using the Article Title: Dehydroepiandrosterone (DHEA)-induced autophagy protects against lipotoxicity in hepatic cells. Article Snippet: Dehydroepiandrosterone (DHEA), a precursor of sex hormones, has been implicated in the pathogenesis of nonalcoholic steatohepatitis (NASH) or metabolic dysfunction-associated steatohepatitis (MASH), with studies suggesting a strong correlation between DHEA levels and disease severity.. In this study, we demonstrated that DHEA alleviated lipotoxicity-induced hepatic damage by promoting autophagy.. Our findings demonstrate that DHEA-induced autophagy is mediated by estrogen receptor alpha (ER-α) and androgen receptor (AR) activation and protects hepatic cells against palmitate-induced apoptosis, steatosis, and inflammasome activation. Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge. Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A, ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CAC TGT ACC ACC AGT AGC AAT AAC CG/CTG ATG GCT GGG AGC TTC ACC AGG AG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the Article Title: Arginine methylation of DDX3 by PRMT1 mediates mitochondrial homeostasis to promote breast cancer metastasis Article Snippet: Dysregulated mitochondrial dynamics and metabolism play important roles in tumorigenesis.. Metastasizing tumor cells predominantly utilize mitochondrial metabolism, and regulators of metabolic reprogramming may provide reliable biomarkers for diagnosing cancer metastasis.. Here, we identified a type I arginine methyltransferase– DEAD-box polypeptide 3, X-linked (PRMT1-DDX3) axis that promotes breast cancer metastasis by coordinating mitochondrial biogenesis and mitophagy to ensure mitochondrial quality control. Article Title: Trametinib boosts palbociclib’s efficacy in breast cancer via autophagy inhibition Article Snippet: .. The Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A , ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CACTGTACCACCAGTAGCAATAACCG/CTGATGGCTGGGAGCTTCACCAGGAG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the Transfection:Article Title: Autophagy-driven MHC-I downregulation enables NK cell-mediated clearance of intracellular uropathogenic E. coli in urinary tract infection Article Snippet: .. The Article Title: Dehydroepiandrosterone (DHEA)-induced autophagy protects against lipotoxicity in hepatic cells. Article Snippet: Dehydroepiandrosterone (DHEA), a precursor of sex hormones, has been implicated in the pathogenesis of nonalcoholic steatohepatitis (NASH) or metabolic dysfunction-associated steatohepatitis (MASH), with studies suggesting a strong correlation between DHEA levels and disease severity.. In this study, we demonstrated that DHEA alleviated lipotoxicity-induced hepatic damage by promoting autophagy.. Our findings demonstrate that DHEA-induced autophagy is mediated by estrogen receptor alpha (ER-α) and androgen receptor (AR) activation and protects hepatic cells against palmitate-induced apoptosis, steatosis, and inflammasome activation. Amplification:Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge. Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A, ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CAC TGT ACC ACC AGT AGC AAT AAC CG/CTG ATG GCT GGG AGC TTC ACC AGG AG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A , ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CACTGTACCACCAGTAGCAATAACCG/CTGATGGCTGGGAGCTTCACCAGGAG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the Clone Assay:Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge. Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A, ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CAC TGT ACC ACC AGT AGC AAT AAC CG/CTG ATG GCT GGG AGC TTC ACC AGG AG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the Article Title: Identification of human host factors required for beta-defensin-2 expression in intestinal epithelial cells upon a bacterial challenge Article Snippet: Briefly, the HBD2 promoter (3.5 kb upstream ATG of the HBD2 gene, also known DEFB4A , ID1673) was amplified from TC7 cell genomic DNA using the PHUSION High-Fidelity DNA Polymerase (Thermo Fisher) with primers from Sigma matching the DNA region (CACTGTACCACCAGTAGCAATAACCG/CTGATGGCTGGGAGCTTCACCAGGAG), and cloned into the pENTR5’-TOPO vector (Thermo Fisher). .. The eGFP reporter gene (enhanced Green Fluorescent Protein) was amplified from the |